pJP102
(Plasmid
#176480)
-
PurposeExpresses mScarlet under control of the Capsaspora EF1 promoter and NatR under control of the Capsaspora actin promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57-mini
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 1835
- Total vector size (bp) 4668
-
Modifications to backboneTo generate a vector for mScarlet expression in Capsaspora, a DNA construct containing an open reading frame encoding the mScarlet protein codon-optimized for expression in Capsaspora and under control of the EF1-α promoter and terminator was constructed by gene synthesis and cloned into the EcoRV site of the pUC57-mini vector (Genscript). A KpnI site and an AflII site were incorporated at the beginning and end of the coding sequence, respectively, allowing for the construction of N or C-terminal protein fusion constructs by Gibson assembly. To incorporate a nourseothricin resistance gene, the nourseothricin acetyltransferase (NatR) gene from pUC18T-mini-Tn7T-nat was codon optimized for Capsaspora, the optimized sequence was synthesized with the promoter and terminator from the Capsaspora actin ortholog gene CAOG_06018, and the synthesized fragment was cloned into the SmaI site of pUC-57 by Gibson assembly.
-
Vector typeCapsaspora owczarzaki expression
-
Selectable markersnourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameactin > NatR
-
SpeciesSynthetic; Capsaspora owczarzaki
-
Insert Size (bp)863
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTCCGCGCACATTTCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEF1 > mScarlet
-
SpeciesSynthetic; Capsaspora owczarzaki
-
Insert Size (bp)1952
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GATTTGGAAATGCTCACTCTTCC
- 3′ sequencing primer TGAAATAAACAAATGTGTCTTGGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe EF-1 promoter sequence was provided as a gift by Dr. Iñaki Ruiz-trillo.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJP102 was a gift from Duojia Pan (Addgene plasmid # 176480 ; http://n2t.net/addgene:176480 ; RRID:Addgene_176480) -
For your References section:
Genome editing in the unicellular holozoan Capsaspora owczarzaki suggests a premetazoan role for the Hippo pathway in multicellular morphogenesis. Phillips JE, Santos M, Konchwala M, Xing C, Pan D. Elife. 2022 Jun 6;11. pii: 77598. doi: 10.7554/eLife.77598. 10.7554/eLife.77598 PubMed 35659869