TetO-FUW-mWnt1
(Plasmid
#176486)
-
Purposemouse Wnt1 cDNA in TetO backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneTetO-FUW
- Backbone size w/o insert (bp) 8393
- Total vector size (bp) 9511
-
Vector typeLentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThe Wernig lab uses JM109 for downstream applications.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemouse Wnt1 cDNA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1113
-
Entrez GeneWnt1 (a.k.a. Int-1, Wnt-1, sw, swaying)
- Promoter TetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TGACCTCCATAGAAGACACC
- 3′ sequencing primer TTTTGTAATCCAGAGGTTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-mWnt1 was a gift from Marius Wernig (Addgene plasmid # 176486 ; http://n2t.net/addgene:176486 ; RRID:Addgene_176486) -
For your References section:
Efficient generation of dopaminergic induced neuronal cells with midbrain characteristics. Ng YH, Chanda S, Janas JA, Yang N, Kokubu Y, Sudhof TC, Wernig M. Stem Cell Reports. 2021 Jul 13;16(7):1763-1776. doi: 10.1016/j.stemcr.2021.05.017. Epub 2021 Jun 24. 10.1016/j.stemcr.2021.05.017 PubMed 34171286