pJP118
(Plasmid
#176494)
-
PurposeExpresses Lifeact-mScarlet under control of the Capsaspora EF1 promoter and HygR under control of the Capsaspora actin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176494 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJP103
- Backbone size w/o insert (bp) 5133
- Total vector size (bp) 5210
-
Modifications to backboneThe Lifeact peptide coding sequence from pLifeAct_mScarlet_N1 (Addgene Plasmid #85054) was codon optimized for Capsaspora owczarzaki, synthesized, and inserted into the KpnI site of pJP103 by gibson assembly.
-
Vector typeCapsaspora owczarzaki expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLifeact peptide
-
SpeciesSynthetic
-
Insert Size (bp)73
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATTTGGAAATGCTCACTCTTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLifeact peptide coding sequence was obtained from the sequence of pLifeAct_mScarlet_N1 (Addgene Plasmid #85054)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJP118 was a gift from Duojia Pan (Addgene plasmid # 176494 ; http://n2t.net/addgene:176494 ; RRID:Addgene_176494) -
For your References section:
Genome editing in the unicellular holozoan Capsaspora owczarzaki suggests a premetazoan role for the Hippo pathway in multicellular morphogenesis. Phillips JE, Santos M, Konchwala M, Xing C, Pan D. Elife. 2022 Jun 6;11. pii: 77598. doi: 10.7554/eLife.77598. 10.7554/eLife.77598 PubMed 35659869