pET29b-AviTag-mEGFP-dspB(E184Q)-6xHis
(Plasmid
#176573)
-
PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein mEGFP-DspB(E184Q), used as a fluorescent probe for detection of biofilm polysaccharide PNAG.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET29b
- Backbone size w/o insert (bp) 5322
- Total vector size (bp) 7245
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDispersin B
-
Alt nameDspB
-
SpeciesAggregatibacter actinomycetemcomitans
-
Insert Size (bp)1923
-
MutationE184Q
-
GenBank IDAY228551.1
- Promoter T7
-
Tags
/ Fusion Proteins
- mEGFP (N terminal on insert)
- Hexahistidine tag (C terminal on insert)
- Avitag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Narayanan Ramasubbu Rutgers School of Dental Medicine
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET29b-AviTag-mEGFP-dspB(E184Q)-6xHis was a gift from Mark Nitz (Addgene plasmid # 176573 ; http://n2t.net/addgene:176573 ; RRID:Addgene_176573) -
For your References section:
Applications of an inactive Dispersin B probe to monitor biofilm polysaccharide production. Eddenden A, Nitz M. Methods Enzymol. 2022;665:209-231. doi: 10.1016/bs.mie.2021.11.006. Epub 2021 Dec 7. 10.1016/bs.mie.2021.11.006 PubMed 35379435