Skip to main content

pET29b-mVenus-dspB(E184Q W330Y)-6xHis
(Plasmid #176577)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176577 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET29b
  • Backbone size w/o insert (bp) 5313
  • Total vector size (bp) 7152
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Dispersin B
  • Alt name
    DspB
  • Species
    Aggregatibacter actinomycetemcomitans
  • Insert Size (bp)
    1839
  • Mutation
    E184Q W330Y
  • GenBank ID
    AY228551.1
  • Promoter T7
  • Tags / Fusion Proteins
    • mVenus (N terminal on insert)
    • Hexahistidine tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Narayanan Ramasubbu Rutgers School of Dental Medicine

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29b-mVenus-dspB(E184Q W330Y)-6xHis was a gift from Mark Nitz (Addgene plasmid # 176577 ; http://n2t.net/addgene:176577 ; RRID:Addgene_176577)
  • For your References section:

    Applications of an inactive Dispersin B probe to monitor biofilm polysaccharide production. Eddenden A, Nitz M. Methods Enzymol. 2022;665:209-231. doi: 10.1016/bs.mie.2021.11.006. Epub 2021 Dec 7. 10.1016/bs.mie.2021.11.006 PubMed 35379435