BL21 ΔrecBCD
(Bacterial strain
#176581)
-
PurposeE. coli BL21 strain (with recBCD genomic locus deleted) for making cell-free extracts for Linear DNA expression.
-
Depositing Labs
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 176581 | Bacteria in agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneStrain
-
Modifications to backboneThis modified strain was originally made from BL21 Rosetta2. It lost the pRARE2 plasmid during the recBCD genomic deletion process.
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)BL21 ΔrecBCD
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThis is a strain.
-
MutationrecBCD genomic deletion
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BL21 ΔrecBCD was a gift from Chase Beisel & Jean-Loup Faulon (Addgene plasmid # 176581) -
For your References section:
Differentially Optimized Cell-Free Buffer Enables Robust Expression from Unprotected Linear DNA in Exonuclease-Deficient Extracts. Batista AC, Levrier A, Soudier P, Voyvodic PL, Achmedov T, Reif-Trauttmansdorff T, DeVisch A, Cohen-Gonsaud M, Faulon JL, Beisel CL, Bonnet J, Kushwaha M. ACS Synth Biol. 2022 Jan 16. doi: 10.1021/acssynbio.1c00448. 10.1021/acssynbio.1c00448 PubMed 35034449