Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEM-Isce-Tol2-Tn5-neo
(Plasmid #176619)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176619 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEM-T
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 4300
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    I-SceI sites, Tol2 repeats and Tn5-neo cassette
  • Species
    Synthetic

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer ATTTAGGTGACACTATAGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-Isce-Tol2-Tn5-neo was a gift from Nathan Lawson (Addgene plasmid # 176619 ; http://n2t.net/addgene:176619 ; RRID:Addgene_176619)
  • For your References section:

    Integrated molecular analysis identifies a conserved pericyte gene signature in zebrafish. Shih YH, Portman D, Idrizi F, Grosse A, Lawson ND. Development. 2021 Nov 9. pii: 273393. doi: 10.1242/dev.200189. 10.1242/dev.200189 PubMed 34751773