Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcAla12
(Plasmid #17680)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 17680 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEVX
  • Backbone size w/o insert (bp) 6400
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    c-src S12A
  • Alt name
    c-Src
  • Alt name
    src
  • Species
    G. gallus (chicken)
  • Mutation
    Ser 12 changed to Ala.
  • Entrez Gene
    SRC (a.k.a. PP60C-SCR, SDR, c-src)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pM5HHB5 c-src sequence between nucleotide 1 (numbering from the c-src translational initiator ATG) and nucleotide 43 (at an NaeI site) was replaced with the sequence ATGGGGAGTAGCAAGAGCAAGCCTAAGGATC
CCGCTCAGCGCC in pcAlal2. This introduced MstII and BamHI restriction sites near
nucleotides 25 and 29, respectively, and changed the AGC (Ser) 12 codon to GCT (Ala) codon yet preserved the remaining the c-src amino acid sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcAla12 was a gift from David Shalloway (Addgene plasmid # 17680 ; http://n2t.net/addgene:17680 ; RRID:Addgene_17680)
  • For your References section:

    Mutation of amino acids in pp60c-src that are phosphorylated by protein kinases C and A. Yaciuk P, Choi JK, Shalloway D. Mol Cell Biol. 1989 Jun . 9(6):2453-63. PubMed 2474754