Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

330-cherry-hCYP3A4-enhancer-L-sgRNA
(Plasmid #176840)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176840 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    330-cherry
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human CYP3A4 proximal enhancer left boundary
  • gRNA/shRNA sequence
    GCACATGGTAAACACTAAGA
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgattcc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    330-cherry-hCYP3A4-enhancer-L-sgRNA was a gift from Rudolf Jaenisch (Addgene plasmid # 176840 ; http://n2t.net/addgene:176840 ; RRID:Addgene_176840)
  • For your References section:

    The nuclear receptor THRB facilitates differentiation of human PSCs into more mature hepatocytes. Ma H, de Zwaan E, Guo YE, Cejas P, Thiru P, van de Bunt M, Jeppesen JF, Syamala S, Dall'Agnese A, Abraham BJ, Fu D, Garrett-Engele C, Lee TI, Long HW, Griffith LG, Young RA, Jaenisch R. Cell Stem Cell. 2022 Apr 13. pii: S1934-5909(22)00150-3. doi: 10.1016/j.stem.2022.03.015. 10.1016/j.stem.2022.03.015 PubMed 35452598