Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hSyn-FRISZ-TM
(Plasmid #176886)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176886 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-hSyn
  • Backbone size w/o insert (bp) 4280
  • Total vector size (bp) 5365
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ig kappa-FRISZ-PDGFR TM
  • Species
    Synthetic
  • Insert Size (bp)
    1086
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cctcagtctgcggtggg
  • 3′ sequencing primer ccagtcaatctttcacaaattttgtaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The N-terminal Ig kappa leader sequence is for targeting the synthesized peptide to the secretory pathway. The C-terminal PDGFR transmembrane domain is for anchoring the protein to the mammalian cell surface. AAV derived from this plasmid has been successfully used for wide-field in vivo imaging. We deposit another plasmid, pAAV-hSyn-FRISZ-GPI (Addgene # 177264, not yet tested in vivo), which uses a CD59 leader sequence for secretory pathway targeting and a CD59 GPI for anchoring. We plan to systematically compare various exporting and anchoring strategies.

Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-FRISZ-TM was a gift from Huiwang Ai (Addgene plasmid # 176886 ; http://n2t.net/addgene:176886 ; RRID:Addgene_176886)
  • For your References section:

    A genetically encoded far-red fluorescent indicator for imaging synaptically released Zn(2). Wu T, Kumar M, Zhang J, Zhao S, Drobizhev M, McCollum M, Anderson CT, Wang Y, Pokorny A, Tian X, Zhang Y, Tzounopoulos T, Ai HW. Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1. 10.1126/sciadv.add2058 PubMed 36857451