pDisplay-FRISZ
(Plasmid #176887)

• Purpose: Far-red fluorescent zinc indicator FRISZ in pDisplay
• Depositing Lab: Huiwang Ai
• Depositing Organization: University of Virginia
  Located in United States of America
• Publication: Wu et al Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1.

Backbone

• Vector backbone: pDisplay
• Backbone size w/o insert (bp): 828
• Total vector size (bp): 6091
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FRISZ
• Species: Synthetic
• Insert Size (bp): 828
• GenBank ID:
• Promoter: CMV
• Tag / Fusion Protein:
  • pDisplay backbone elements for export and membrane anchor

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: tagaaggcacagtcgagg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When selecting zinc biosensors for your particular application, please pay attention to the Kd. The Kd of the sensor has to match the concentration range of your particular experiments.

Please note: The plasmid contains a LD amino acid insertion before amino acid 158 and a Q158E mutation in the NeoR/KanR. The plasmid also contains a 7 bp deletion in the SV40 promoter. These differences are not known to affect plasmid function.

Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.

DNA (Catalog # 176887-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 176887-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.