pDisplay-FRISZ
(Plasmid
#176887)
-
PurposeFar-red fluorescent zinc indicator FRISZ in pDisplay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDisplay
- Backbone size w/o insert (bp) 828
- Total vector size (bp) 6091
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFRISZ
-
SpeciesSynthetic
-
Insert Size (bp)828
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- pDisplay backbone elements for export and membrane anchor
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When selecting zinc biosensors for your particular application, please pay attention to the Kd. The Kd of the sensor has to match the concentration range of your particular experiments.
Please note: The plasmid contains a LD amino acid insertion before amino acid 158 and a Q158E mutation in the NeoR/KanR. The plasmid also contains a 7 bp deletion in the SV40 promoter. These differences are not known to affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-FRISZ was a gift from Huiwang Ai (Addgene plasmid # 176887 ; http://n2t.net/addgene:176887 ; RRID:Addgene_176887) -
For your References section:
A genetically encoded far-red fluorescent indicator for imaging synaptically released Zn(2). Wu T, Kumar M, Zhang J, Zhao S, Drobizhev M, McCollum M, Anderson CT, Wang Y, Pokorny A, Tian X, Zhang Y, Tzounopoulos T, Ai HW. Sci Adv. 2023 Mar;9(9):eadd2058. doi: 10.1126/sciadv.add2058. Epub 2023 Mar 1. 10.1126/sciadv.add2058 PubMed 36857451