pSBbi-moxGFP-P2A-T2A-cMyc-Puro
(Plasmid
#176892)
-
PurposeSleeping Beauty transposon-based vector for mammalian polycistronic expression of moxGFP, c-Myc and an additional gene of interest
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBbi-Pur (Addgene Plasmid #60523)
-
Backbone manufacturerEric Kowarz
- Backbone size w/o insert (bp) 5857
- Total vector size (bp) 7814
-
Modifications to backboneInsertion of moxGFP-P2A-T2A-c-Myc construct
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemoxGFP-P2A-T2A-c-Myc
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2181
-
GenBank IDNM_002467.6
- Promoter EF1a/RPBSA
-
Tags
/ Fusion Proteins
- Myc (C terminal on insert)
- moxGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
- 3′ sequencing primer AGGCACAGTCGAGGCTGAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The moxGFP-P2A-T2A-c-Myc construct was designed by Jorge L. Arias-Arias from Universidad de Costa Rica ([email protected]) It was codon optimized for human and mouse expression and includes an additional cloning site (5' EcoRV - 3' SalI, see the map uploaded by the depositor) for the polycistronic expression of up to three genes: moxGFP, c-Myc and one more. This vector is suitable for transient transfection, but it was intended to be co-transfected with the transposase vector pCMV(CAT)T7-SB100 (Addgene Plasmid #34879) in order to generate mammalian cells with stable expression of the genes of interest. Enjoy!
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-moxGFP-P2A-T2A-cMyc-Puro was a gift from Jorge Luis Arias-Arias (Addgene plasmid # 176892 ; http://n2t.net/addgene:176892 ; RRID:Addgene_176892) -
For your References section:
MYC dosage compensation is mediated by miRNA-transcription factor interactions in aneuploid cancer. Acon M, Geiss C, Torres-Calvo J, Bravo-Estupinan D, Oviedo G, Arias-Arias JL, Rojas-Matey LA, Edwin B, Vasquez-Vargas G, Oses-Vargas Y, Guevara-Coto J, Segura-Castillo A, Siles-Canales F, Quiros-Barrantes S, Regnier-Vigouroux A, Mendes P, Mora-Rodriguez R. iScience. 2021 Nov 8;24(12):103407. doi: 10.1016/j.isci.2021.103407. eCollection 2021 Dec 17. 10.1016/j.isci.2021.103407 PubMed 34877484