U6-pegRNA-H1-nick sgRNA-mCherry
(Plasmid
#176901)
-
PurposeExpresses prime editing guide RNA and guide RNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepx552
- Total vector size (bp) 6551
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)708
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aaccatgttcatgccttctt
- 3′ sequencing primer ccacccgtagatctctcg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA scaffold
-
SpeciesSynthetic
-
Insert Size (bp)76
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaagtatttcgatttcttggc
- 3′ sequencing primer GCCCGCGATTCCTTGGAG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namegRNA scaffold
-
SpeciesSynthetic
-
Insert Size (bp)76
- Promoter H1
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTCTTTGGATTTGGGAAT
- 3′ sequencing primer gaccccgtaattgattactatt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-pegRNA-H1-nick sgRNA-mCherry was a gift from Hyongbum Kim (Addgene plasmid # 176901 ; http://n2t.net/addgene:176901 ; RRID:Addgene_176901) -
For your References section:
Application of prime editing to the correction of mutations and phenotypes in adult mice with liver and eye diseases. Jang H, Jo DH, Cho CS, Shin JH, Seo JH, Yu G, Gopalappa R, Kim D, Cho SR, Kim JH, Kim HH. Nat Biomed Eng. 2021 Aug 26. pii: 10.1038/s41551-021-00788-9. doi: 10.1038/s41551-021-00788-9. 10.1038/s41551-021-00788-9 PubMed 34446856