pDAS12069_U6-pegRNA-mCherry
(Plasmid
#177180)
-
Purpose(Empty Backbone) pegRNA cloning plasmid with mCherry marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
-
Vector typeMammalian Expression, CRISPR
- Promoter U6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.26.441486v1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDAS12069_U6-pegRNA-mCherry was a gift from Ervin Welker (Addgene plasmid # 177180 ; http://n2t.net/addgene:177180 ; RRID:Addgene_177180) -
For your References section:
PEAR, a flexible fluorescent reporter for the identification and enrichment of successfully prime edited cells. Simon DA, Talas A, Kulcsar PI, Biczok Z, Krausz SL, Varady G, Welker E. Elife. 2022 Feb 23;11. pii: 69504. doi: 10.7554/eLife.69504. 10.7554/eLife.69504 PubMed 35196219