pBAD-tdTEVDB_C-15A/G4C
(Plasmid
#177205)
-
PurposePermuted td intron with evolved initiation sequence for the expression of circular mRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 3912
- Total vector size (bp) 4999
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions20 mM Mg2+ for optimal protein expression
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePermuted GFP with evolved initiation sequence for circular mRNA
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)1163
-
MutationPermuted sfGFP after residue 52 & Changed Cytosine -15 to Adenine and Guanine 4 to Cytosine in the initiation sequence
-
GenBank IDGenBank: AKC96462.1
- Promoter araBAD
-
Tag
/ Fusion Protein
- 6x His
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer 5' ACTCTCTACTGTTTCTCCATACCC 3'
- 3′ sequencing primer 5' CCTTTCGTTTTATTTGATGCCTGG 3'
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-tdTEVDB_C-15A/G4C was a gift from Stephen Fried (Addgene plasmid # 177205 ; http://n2t.net/addgene:177205 ; RRID:Addgene_177205) -
For your References section:
Optimized Loopable Translation as a Platform for the Synthesis of Repetitive Proteins. Lee SO, Xie Q, Fried SD. ACS Cent Sci. 2021 Oct 27;7(10):1736-1750. doi: 10.1021/acscentsci.1c00574. Epub 2021 Sep 24. 10.1021/acscentsci.1c00574 PubMed 34729417