Skip to main content

pBAD-tdTEVDB_C-15A/G4C
(Plasmid #177205)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177205 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAD
  • Backbone size w/o insert (bp) 3912
  • Total vector size (bp) 4999
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    20 mM Mg2+ for optimal protein expression
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Permuted GFP with evolved initiation sequence for circular mRNA
  • Species
    Synthetic; Aequorea victoria
  • Insert Size (bp)
    1163
  • Mutation
    Permuted sfGFP after residue 52 & Changed Cytosine -15 to Adenine and Guanine 4 to Cytosine in the initiation sequence
  • GenBank ID
    GenBank: AKC96462.1
  • Promoter araBAD
  • Tag / Fusion Protein
    • 6x His

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer 5' ACTCTCTACTGTTTCTCCATACCC 3'
  • 3′ sequencing primer 5' CCTTTCGTTTTATTTGATGCCTGG 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-tdTEVDB_C-15A/G4C was a gift from Stephen Fried (Addgene plasmid # 177205 ; http://n2t.net/addgene:177205 ; RRID:Addgene_177205)
  • For your References section:

    Optimized Loopable Translation as a Platform for the Synthesis of Repetitive Proteins. Lee SO, Xie Q, Fried SD. ACS Cent Sci. 2021 Oct 27;7(10):1736-1750. doi: 10.1021/acscentsci.1c00574. Epub 2021 Sep 24. 10.1021/acscentsci.1c00574 PubMed 34729417