Skip to main content

pRSF-G1TFAKRS
(Plasmid #177311)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177311 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSF
  • Backbone size w/o insert (bp) 2452
  • Total vector size (bp) 3274
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tRNA synthetase
  • Alt name
    G1TFAKRS
  • Species
    Methanogenic archaeon ISO4-G1
  • Insert Size (bp)
    822
  • Promoter T7

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSF-G1TFAKRS was a gift from Thomas Huber (Addgene plasmid # 177311 ; http://n2t.net/addgene:177311 ; RRID:Addgene_177311)
  • For your References section:

    Through-Space Scalar (19)F-(19)F Couplings between Fluorinated Noncanonical Amino Acids for the Detection of Specific Contacts in Proteins. Orton HW, Qianzhu H, Abdelkader EH, Habel EI, Tan YJ, Frkic RL, Jackson CJ, Huber T, Otting G. J Am Chem Soc. 2021 Nov 15. doi: 10.1021/jacs.1c10104. 10.1021/jacs.1c10104 PubMed 34780162