pAAV-hSyn-fDIO-mCherry-WPREpA
(Plasmid
#177328)
-
PurposeControl vector for Flp-dependent DREADD constructs
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAddgene plasmid #154867
-
Backbone manufacturerGether lab - modified from Addgene plasmid #55641
- Backbone size w/o insert (bp) 4820
- Total vector size (bp) 5535
-
Modifications to backboneNone
-
Vector typeMammalian Expression, AAV ; FLP-FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)711
- Promoter Human Synapsin-1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer actcagcgctgcctcagtct
- 3′ sequencing primer gatacaaaggcattaaagcagcg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Control plasmid for Flp-dependent DREADD vectors
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-fDIO-mCherry-WPREpA was a gift from Ulrik Gether (Addgene plasmid # 177328 ; http://n2t.net/addgene:177328 ; RRID:Addgene_177328)