pF1-Hs Cdk1/cyclin B1/Cks1
(Plasmid
#177329)
-
PurposeCo-expression of the human active Cdk1/cyclin B1/Cks1 kinase complex
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177329 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepF1
- Backbone size w/o insert (bp) 6424
- Total vector size (bp) 8854
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCyclin-dependent kinase 1
-
Alt nameCDK1
-
Alt nameCDC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)891
-
GenBank IDCAA28963.1
-
Entrez GeneCDK1 (a.k.a. CDC2, CDC28A, P34CDC2)
- Promoter polh
-
Tag
/ Fusion Protein
- 8 x His (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAGATTACACCAAGATCGA
- 3′ sequencing primer CATCTTCTTGATCTGGTTGT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameG2/mitotic-specific cyclin-B1
-
Alt nameCCNB1
-
Alt namecyclin B1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1299
-
GenBank IDBAF82120.1
-
Entrez GeneCCNB1 (a.k.a. CCNB)
- Promoter p10
-
Tag
/ Fusion Protein
- 2 x Strep-tag (C terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CACCTTAGCCACAGCCTTAG
- 3′ sequencing primer GCTCTGCGTGTGACCCGTAA
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCyclin-dependent kinases regulatory subunit 1
-
Alt nameCKS1B
-
Alt nameCKS1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)240
-
GenBank IDCAA38702.1
-
Entrez GeneCKS1B (a.k.a. CKS1, PNAS-16, PNAS-18, ckshs1)
- Promoter p10
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTCTTGGGCTTCTTAGGCA
- 3′ sequencing primer TCCCACAAGCAGATCTACTA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genes are gene-optimised for insect cell expression and have been ordered from GeneArts.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF1-Hs Cdk1/cyclin B1/Cks1 was a gift from Andreas Boland (Addgene plasmid # 177329 ; http://n2t.net/addgene:177329 ; RRID:Addgene_177329) -
For your References section:
Structural basis of human separase regulation by securin and CDK1-cyclin B1. Yu J, Raia P, Ghent CM, Raisch T, Sadian Y, Cavadini S, Sabale PM, Barford D, Raunser S, Morgan DO, Boland A. Nature. 2021 Aug;596(7870):138-142. doi: 10.1038/s41586-021-03764-0. Epub 2021 Jul 21. 10.1038/s41586-021-03764-0 PubMed 34290405