Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pF1-Hs Cdk1/cyclin B1/Cks1
(Plasmid #177329)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177329 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pF1
  • Backbone size w/o insert (bp) 6424
  • Total vector size (bp) 8854
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cyclin-dependent kinase 1
  • Alt name
    CDK1
  • Alt name
    CDC2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    891
  • GenBank ID
    CAA28963.1
  • Entrez Gene
    CDK1 (a.k.a. CDC2, CDC28A, P34CDC2)
  • Promoter polh
  • Tag / Fusion Protein
    • 8 x His (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAAGATTACACCAAGATCGA
  • 3′ sequencing primer CATCTTCTTGATCTGGTTGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    G2/mitotic-specific cyclin-B1
  • Alt name
    CCNB1
  • Alt name
    cyclin B1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1299
  • GenBank ID
    BAF82120.1
  • Entrez Gene
    CCNB1 (a.k.a. CCNB)
  • Promoter p10
  • Tag / Fusion Protein
    • 2 x Strep-tag (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACCTTAGCCACAGCCTTAG
  • 3′ sequencing primer GCTCTGCGTGTGACCCGTAA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Cyclin-dependent kinases regulatory subunit 1
  • Alt name
    CKS1B
  • Alt name
    CKS1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    240
  • GenBank ID
    CAA38702.1
  • Entrez Gene
    CKS1B (a.k.a. CKS1, PNAS-16, PNAS-18, ckshs1)
  • Promoter p10

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTCTTGGGCTTCTTAGGCA
  • 3′ sequencing primer TCCCACAAGCAGATCTACTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genes are gene-optimised for insect cell expression and have been ordered from GeneArts.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF1-Hs Cdk1/cyclin B1/Cks1 was a gift from Andreas Boland (Addgene plasmid # 177329 ; http://n2t.net/addgene:177329 ; RRID:Addgene_177329)
  • For your References section:

    Structural basis of human separase regulation by securin and CDK1-cyclin B1. Yu J, Raia P, Ghent CM, Raisch T, Sadian Y, Cavadini S, Sabale PM, Barford D, Raunser S, Morgan DO, Boland A. Nature. 2021 Aug;596(7870):138-142. doi: 10.1038/s41586-021-03764-0. Epub 2021 Jul 21. 10.1038/s41586-021-03764-0 PubMed 34290405