Skip to main content

pGLOW77
(Plasmid #177338)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177338 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N/A
  • Backbone size w/o insert (bp) 2445
  • Total vector size (bp) 5110
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pmyo-2::mNeonGreen
  • Alt name
    Pmyo-2::mNG-C1::unc-54utr
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    2663
  • Promoter myo-2
  • Tag / Fusion Protein
    • mNeonGreen

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCAGGGAAAAAGAAGGGCT
  • 3′ sequencing primer GGGAGCACAGGGAGAAAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Derived from pGLOW30 (Addgene #172697) and pDD268 (Addgene #132523)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

C. elegans codon-optimized mNeonGreen. Use as an array marker for CRISPR or as a general co-injection marker. Very bright mNG fluorescence in pharyngeal muscle. Inject at 2.5 ng/uL. Made by George Huang (Glow Worms '20).

pGLOW77 has 11 random mutations relative to the pCFJ90 backbone that do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGLOW77 was a gift from Ryan Doonan (Addgene plasmid # 177338 ; http://n2t.net/addgene:177338 ; RRID:Addgene_177338)
  • For your References section:

    mScarlet and split fluorophore mScarlet resources for plasmid-based CRISPR/Cas9 knock-in in C. elegans. Witten G, DeMott E, Huang G, Zelasko F, de Jesus B, Mulchand C, Schuck L, Pullman S, Perez A, Mahableshwarkar P, Wu Z, Cardona EA, Pierce JT, Dickinson DJ, Doonan R. MicroPubl Biol. 2023 Jun 14;2023:10.17912/micropub.biology.000871. doi: 10.17912/micropub.biology.000871. eCollection 2023. 10.17912/micropub.biology.000871 PubMed 37396790