Skip to main content

Venus-7aa-ActA-pEGFP-C1
(Plasmid #177405)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177405 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ActA tail anchor
  • Alt name
    Venus-ActA, V-ActA, VActA
  • Species
    Listeria monocytogenes
  • Entrez Gene
    actA (a.k.a. lmo0204)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    See gene entry for "actin assembly-inducing protein ActA" (NCBI Reference Sequence: WP_110138194.1). Here we have used only the C-terminal tail anchor sequence of this protein. Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of ActA tail anchor sequence: "LILAMLAIGVFSLGAFIKIIQLRKNN", which targets the mitochondrial outer membrane and signal correlates with mitotracker Red signal in cells. "7aa" indicates the 7 aa flexible linker region, "SGLRSRV" between Venus and the ActA targeting signal. This Venus protein contains an F224R mutation to make it monomeric.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-7aa-ActA-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177405 ; http://n2t.net/addgene:177405 ; RRID:Addgene_177405)
  • For your References section:

    Automated, quantitative Fast FLIM-FRET (qF3): A step-by-step protocol to measure dissociation constants for protein-protein interactions in live-cell screening applications. Osterlund EJ, Hirmiz N, Pemberton JM, Fang Q, Andrews DW. Protocol Exchange (2022) 10.21203/rs.3.pex-1354/v1