Venus-BclXL-pEGFP-C1
(Plasmid
#177409)
-
PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bcl-XL.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBcl-XL
-
Alt nameVBclXL, VBcl-XL, Venus-Bcl-XL, Bcl2 like protein 1 (Bcl2l1)
-
SpeciesH. sapiens (human)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBclXL sequence aligns with NCBI Reference Sequence: NM_001317919.2 of H. sapiens BCL2 like 1 (BCL2L1), transcript variant 3, mRNA. Venus sequence received from Dr. Ray Truant (McMaster University).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express Venus-fused to the N-terminus of Bcl-XL. There is a flexible, 7 aa linker "SGLRSTR", between Venus and BclXL. This Venus protein contains an F224R mutation to make it monomeric.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-BclXL-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177409 ; http://n2t.net/addgene:177409 ; RRID:Addgene_177409) -
For your References section:
Differences in the mechanisms of proapoptotic BH3 proteins binding to Bcl-XL and Bcl-2 quantified in live MCF-7 cells. Aranovich A, Liu Q, Collins T, Geng F, Dixit S, Leber B, Andrews DW. Mol Cell. 2012 Mar 30;45(6):754-63. doi: 10.1016/j.molcel.2012.01.030. 10.1016/j.molcel.2012.01.030 PubMed 22464442