mCerulean3-BclXL-ActA-s2193
(Plasmid
#177411)
-
PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-ActA: Bcl-XL with its membrane binding region swapped for ActA (mitochondrial targeting sequence).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbones2193
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Blasticidin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBcl-XL-ActA, BclX-acta
-
Alt nameCBclXL-ActA, CBcl-XL-ActA, mCerulean3-Bcl-XL-ActA, mCer3-BclXL-ActA
-
SpeciesH. sapiens (human)
- Promoter Human ferritin
-
Tag
/ Fusion Protein
- mCerulean3 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CCTTGAGTTTTGAGCGGAGCTAA
- 3′ sequencing primer TTACCCCTCTAGACCTGGAAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySee Pubmed ID: 16928273 for description of chimera Bcl-XL-ActA (aka BclX-acta). mCerulean3 sequence received from Mark Rizzo PMID: 21479270.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-XL-ActA. There is a flexible, 7 aa linker "SGLRSTR", between mCerulean3 and
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCerulean3-BclXL-ActA-s2193 was a gift from David Andrews (Addgene plasmid # 177411 ; http://n2t.net/addgene:177411 ; RRID:Addgene_177411)