mCerulean3-Bcl2-pEGFP-C1
(Plasmid
#177416)
-
PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family protein, Bcl-2.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBcl-2
-
Alt nameCBcl2, CBcl-2, mCerulean3-Bcl-2, mCer3-Bcl2
-
SpeciesH. sapiens (human)
-
Entrez GeneBCL2 (a.k.a. Bcl-2, PPP1R50)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCerulean3 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHuman Bcl2 sequence aligns with Genebank accession # M14745.1, except there is a M156I alteration in the coding sequence. The mutation was in the original clone (Janiak et al., 1994) published in JBC, and has been used to inhibit apoptosis by our group and many others. It has always been our assumption that this mutation is a naturally occurring variant. Our clone has been used in many publications as the plasmid was widely distributed when it was first assembled and published. Janiak F, Leber B, Andrews DW. Assembly of Bcl-2 into microsomal and outer mitochondrial membranes. J Biol Chem. 1994 Apr 1;269(13):9842-9. PMID: 8144576. mCerulean3 sequence received from Mark Rizzo PMID: 21479270.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-2. There is a flexible, 7 aa linker "SGLRSTR", between mCerulean3 and Bcl2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCerulean3-Bcl2-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177416 ; http://n2t.net/addgene:177416 ; RRID:Addgene_177416) -
For your References section:
Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026