mCerulean3-Bcl2-ActA-pEGFP-C1
(Plasmid
#177418)
-
PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-ActA: Bcl-2 with its membrane binding region swapped for ActA (mitochondrial targeting sequence).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBcl-2-ActA, Bcl2-acta, Bcl-acta
-
Alt nameCBcl2-ActA, CBcl-2-ActA, mCerulean3-Bcl-2-ActA, mCer3-Bcl2-ActA
-
SpeciesH. sapiens (human)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCerulean3 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySee PMID: 8861942 for description of chimera Bcl2-ActA (aka Bcl-ActA). mCerulean3 sequence received from Mark Rizzo PMID: 21479270.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-2-ActA. There is a flexible, 7 aa linker "SGLRSTR", between mCerulean3 and Bcl-2-ActA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCerulean3-Bcl2-ActA-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177418 ; http://n2t.net/addgene:177418 ; RRID:Addgene_177418)