Venus-30aa-Noxa-4E-pEGFP-C1
(Plasmid
#177424)
-
PurposeTo express Venus fused to Noxa-4E, with a longer linker sequence between compared to Addgene #166745.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNoxa, PMA-induced protein 1
-
Alt nameVenus-Noxa-4E, V-Noxa-4E, VNoxa-4E
-
SpeciesH. sapiens (human)
-
Mutation4 hydrophobic residues in the BH3 region mutated to glutamic acid
-
Entrez GenePMAIP1 (a.k.a. APR, NOXA)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNoxa sequence aligns with phorbol-12-myristate-13-acetate-induced protein 1 isoform 6 [H. sapiens] (NCBI Reference Sequence: NM_021127.3). Venus sequence received from Dr. Ray Truant (McMaster University).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express Venus-fused to the N-terminus of Noxa. Noxa BH3 region has hydrophobic positions H1-H4 mutated to glutamic acid (E), refered to as "BH3-4E" mutation, BH3 mutations: C25E, L29E, F32E, L36E. Linked by a 30 aa (aa) flexible linker, "SGLTSGALETRPGGTAGPVAGETRGRSRGG". This Venus protein contains an A207K, F224R and L232H mutations to make it monomeric. An additional A164V mutation in Venus occured in this construct, which does not appear to affect fluorescence of the protein.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-30aa-Noxa-4E-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177424 ; http://n2t.net/addgene:177424 ; RRID:Addgene_177424)