Skip to main content

mCerulean3-Bik-s2193
(Plasmid #177425)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177425 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    s2193
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Blasticidin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Bik, Bcl-2-interacting killer, or Apoptosis inducer NBK
  • Alt name
    CBik, mCerulean3-Bik, mCer3-Bik
  • Species
    H. sapiens (human)
  • Entrez Gene
    BIK (a.k.a. BIP1, BP4, NBK)
  • Promoter Human ferritin
  • Tag / Fusion Protein
    • mCerulean3 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCTTGAGTTTTGAGCGGAGCTAA
  • 3′ sequencing primer TTACCCCTCTAGACCTGGAAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Bik sequence aligns with H. sapiens BCL2 interacting killer (BIK), mRNA; NCBI Reference Sequence: NM_001197.5. mCerulean3 sequence received from Mark Rizzo PMID: 21479270.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bik. There is a flexible, 4 aa linker "SRGG", between mCerulean3 and Bik.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCerulean3-Bik-s2193 was a gift from David Andrews (Addgene plasmid # 177425 ; http://n2t.net/addgene:177425 ; RRID:Addgene_177425)