Skip to main content

Venus-Bik-GG153AA-pEGFP-C1
(Plasmid #177427)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177427 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bik, Bcl-2-interacting killer, or Apoptosis inducer NBK
  • Alt name
    VBik-GG153AA, V-Bik-GG153AA, Venus-Bik-GG153AA
  • Species
    H. sapiens (human)
  • Mutation
    Glycines 153 and 154 mutated to alanine
  • Entrez Gene
    BIK (a.k.a. BIP1, BP4, NBK)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Bik sequence aligns with H. sapiens BCL2 interacting killer (BIK), mRNA; NCBI Reference Sequence: NM_001197.5. Venus sequence received from Dr. Ray Truant (McMaster University).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express Venus-fused to the N-terminus of Bik-GG153AA. There is a flexible, 8 aa linker "SGLRSRGG", between Venus and Bik-GG153AA. This Venus protein contains an F224R mutation to make it monomeric.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-Bik-GG153AA-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177427 ; http://n2t.net/addgene:177427 ; RRID:Addgene_177427)