Venus-Bik-delMBR-pEGFP-C1
(Plasmid
#177432)
-
PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with its membrane binding region (MBR) deleted (Bik(1-136)). Compare to full length Addgene #166737.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177432 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBik, Bcl-2-interacting killer, or Apoptosis inducer NBK
-
Alt nameVBik-delMBR, V-Bik-delMBR, Venus-Bik-delMBR, VBik-delTM, V-Bik-delTM, Venus-Bik-delTM
-
SpeciesH. sapiens (human)
-
MutationBik MBR removed (after position 136)
-
Entrez GeneBIK (a.k.a. BIP1, BP4, NBK)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBik sequence aligns with H. sapiens BCL2 interacting killer (BIK), mRNA; NCBI Reference Sequence: NM_001197.5 (aas 1-136). Venus sequence received from Dr. Ray Truant (McMaster University).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express Venus-fused to the N-terminus of Bik lacking its MBR. There is a flexible, 8 aa linker "SGLRSRGG", between Venus and Bik. This Venus protein contains an F224R mutation to make it monomeric.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-Bik-delMBR-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 177432 ; http://n2t.net/addgene:177432 ; RRID:Addgene_177432)