pResQ shFEN3 3XF-FEN1 wt
(Plasmid
#17752)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 17752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepResQ shFEN3
- Backbone size w/o insert (bp) 10000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFlap Endonuclease I
-
Alt nameFEN1
-
Alt nameFEN-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1215
-
Entrez GeneFEN1 (a.k.a. FEN-1, MF1, RAD2)
-
Tag
/ Fusion Protein
- Triple Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer GCGCTCGGGGTTGGCGAGTGTG
- 3′ sequencing primer GGAGCCTGGGGACTTTCCACACCTGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pResQ shFEN3 3XF-FEN1 wt was a gift from Sheila Stewart (Addgene plasmid # 17752 ; http://n2t.net/addgene:17752 ; RRID:Addgene_17752)