PIG-MycT58A
(Plasmid
#177648)
-
PurposeExpression of mouse Myc with T58A point mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177648 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7657
- Total vector size (bp) 8966
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyc-T58A
-
Alt namecMyc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1320
-
MutationT58A point mutation
-
GenBank IDNM_001177352.1
-
Entrez GeneMyc (a.k.a. Myc2, Niard, Nird, bHLHe39)
-
Tags
/ Fusion Proteins
- IRES (C terminal on backbone)
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pBabe 5' CTTTATCCAGCCCTCAC
- 3′ sequencing primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PIG-MycT58A was a gift from Trudy Oliver (Addgene plasmid # 177648 ; http://n2t.net/addgene:177648 ; RRID:Addgene_177648) -
For your References section:
MYC Drives Progression of Small Cell Lung Cancer to a Variant Neuroendocrine Subtype with Vulnerability to Aurora Kinase Inhibition. Mollaoglu G, Guthrie MR, Bohm S, Bragelmann J, Can I, Ballieu PM, Marx A, George J, Heinen C, Chalishazar MD, Cheng H, Ireland AS, Denning KE, Mukhopadhyay A, Vahrenkamp JM, Berrett KC, Mosbruger TL, Wang J, Kohan JL, Salama ME, Witt BL, Peifer M, Thomas RK, Gertz J, Johnson JE, Gazdar AF, Wechsler-Reya RJ, Sos ML, Oliver TG. Cancer Cell. 2017 Feb 13;31(2):270-285. doi: 10.1016/j.ccell.2016.12.005. Epub 2017 Jan 12. 10.1016/j.ccell.2016.12.005 PubMed 28089889