pT7C-HSPA1L
(Plasmid
#177660)
-
PurposeRecombinant protein synthesis of human HSPA1L
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT7C
- Backbone size w/o insert (bp) 3352
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsTo produce protein, express in BL21(DE3) Codon Plus RIL. Purify by Ni IMAC and SEC.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHSPA1L
-
Alt nameNP_005518.3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1926
-
Entrez GeneHSPA1L (a.k.a. HSP70-1L, HSP70-HOM, HSP70T, hum70t)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-Thrombin (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GATTATCAACCGGGGTGGCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genes were cloned from a cDNA library and may contain silent mutations. However, all inserts were sequence-verified and any nucleotide changes were mutagenized to encode the consensus amino acid sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7C-HSPA1L was a gift from Jeff Kuret (Addgene plasmid # 177660 ; http://n2t.net/addgene:177660 ; RRID:Addgene_177660) -
For your References section:
Identification of gene networks mediating regional resistance to tauopathy in late-onset Alzheimer's disease. Ayoub CA, Wagner CS, Kuret J. PLoS Genet. 2023 Mar 27;19(3):e1010681. doi: 10.1371/journal.pgen.1010681. eCollection 2023 Mar. 10.1371/journal.pgen.1010681 PubMed 36972319