L4440_BioBrick-hif-1-sgRNA-A
(Plasmid
#177784)
-
PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneL4440_BioBrick-sgRNA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehif-1
-
gRNA/shRNA sequenceAAAAGGACACAAAAAAACTACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT and AGGACACAAAAAAACTATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
-
SpeciesC. elegans (nematode)
-
Entrez Genehif-1 (a.k.a. CELE_F38A6.3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L4440_BioBrick-hif-1-sgRNA-A was a gift from Michael Ristow (Addgene plasmid # 177784 ; http://n2t.net/addgene:177784 ; RRID:Addgene_177784) -
For your References section:
Ingestion of single guide RNAs induces gene overexpression and extends lifespan in C. elegans via CRISPR activation. Fischer F, Benner C, Goyala A, Grigolon G, Vitiello D, Wu J, Zarse K, Ewald CY, Ristow M. J Biol Chem. 2022 May 27:102085. doi: 10.1016/j.jbc.2022.102085. 10.1016/j.jbc.2022.102085 PubMed 35636511