Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFastBac (GST-preSci site-CD45)
(Plasmid #177889)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177889 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFastBacHT
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD45 (aa 598-1304 only)
  • Species
    H. sapiens (human)
  • Mutation
    L652P
  • Entrez Gene
    PTPRC (a.k.a. B220, CD45, CD45R, GP180, IMD105, L-CA, LCA, LY5, T200)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • TEV-GST-PreScission cut site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer GGATTATTCATACCGTCCCA
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac (GST-preSci site-CD45) was a gift from Ron Vale (Addgene plasmid # 177889 ; http://n2t.net/addgene:177889 ; RRID:Addgene_177889)
  • For your References section:

    In vitro membrane reconstitution of the T-cell receptor proximal signaling network. Hui E, Vale RD. Nat Struct Mol Biol. 2014 Feb;21(2):133-42. doi: 10.1038/nsmb.2762. Epub 2014 Jan 26. 10.1038/nsmb.2762 PubMed 24463463