Skip to main content

pLentiCRISPRv1_SDHB
(Plasmid #177981)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177981 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPR v1
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting SDHB
  • gRNA/shRNA sequence
    TCCTTTATCACATACATGTG
  • Species
    H. sapiens (human)
  • Mutation
    N/A
  • Entrez Gene
    SDHB (a.k.a. CWS2, IP, MC2DN4, PGL4, PPGL4, SDH, SDH1, SDH2, SDHIP)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (destroyed during cloning)
  • 3′ cloning site Unknown (destroyed during cloning)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv1_SDHB was a gift from David Sabatini & Jessica Spinelli (Addgene plasmid # 177981 ; http://n2t.net/addgene:177981 ; RRID:Addgene_177981)
  • For your References section:

    Fumarate is a terminal electron acceptor in the mammalian electron transport chain. Spinelli JB, Rosen PC, Sprenger HG, Puszynska AM, Mann JL, Roessler JM, Cangelosi AL, Henne A, Condon KJ, Zhang T, Kunchok T, Lewis CA, Chandel NS, Sabatini DM. Science. 2021 Dec 3;374(6572):1227-1237. doi: 10.1126/science.abi7495. Epub 2021 Dec 2. 10.1126/science.abi7495 PubMed 34855504