Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLentiCRISPRv1_COX4
(Plasmid #177983)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177983 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLentiCRISPR v1
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting COX4
  • Alt name
    sgRNA targeting COX4I1
  • gRNA/shRNA sequence
    GAACTTAATGCGATACACTG
  • Species
    H. sapiens (human)
  • Mutation
    N/A
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (destroyed during cloning)
  • 3′ cloning site Unknown (destroyed during cloning)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv1_COX4 was a gift from David Sabatini & Jessica Spinelli (Addgene plasmid # 177983 ; http://n2t.net/addgene:177983 ; RRID:Addgene_177983)
  • For your References section:

    Fumarate is a terminal electron acceptor in the mammalian electron transport chain. Spinelli JB, Rosen PC, Sprenger HG, Puszynska AM, Mann JL, Roessler JM, Cangelosi AL, Henne A, Condon KJ, Zhang T, Kunchok T, Lewis CA, Chandel NS, Sabatini DM. Science. 2021 Dec 3;374(6572):1227-1237. doi: 10.1126/science.abi7495. Epub 2021 Dec 2. 10.1126/science.abi7495 PubMed 34855504