pKAN43Ag8-GFP
(Plasmid
#178182)
-
PurposePlant binary vector expressing GFP by a enhanced 35S promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepKAN43Ag8
- Backbone size w/o insert (bp) 10232
- Total vector size (bp) 10952
-
Vector typePlant Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsSelection with ampicillin tends to produce satellite colonies, so selection with 100 mg/l carbenicillin is recommended.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Insert Size (bp)720
-
MutationThe CAT is inserted after the start codon.
-
GenBank ID
-
Entrez GeneeGFP (a.k.a. pPRS3a_01)
- Promoter The minimal 35S promoter from Cauliflower Mosaic Virus and the tetramer of its enhancer region.
Cloning Information
- Cloning method Other
- 5′ sequencing primer TTCGcaagacccttcctcta
- 3′ sequencing primer CCAACAAAACATTCACAATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The kanamycin resistance gene in this vector has base substitutions compared to the original sequence, but this is not a problem for selection in plants. The NdeI site of pVS1 in this vector is deleted due to mutation, but this has not caused any problems with growth in bacteria or transformation into plants.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKAN43Ag8-GFP was a gift from Keiichi Shimizu (Addgene plasmid # 178182 ; http://n2t.net/addgene:178182 ; RRID:Addgene_178182)