Skip to main content

pKAN43Ag8-GFP
(Plasmid #178182)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178182 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pKAN43Ag8
  • Backbone size w/o insert (bp) 10232
  • Total vector size (bp) 10952
  • Vector type
    Plant Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Selection with ampicillin tends to produce satellite colonies, so selection with 100 mg/l carbenicillin is recommended.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    720
  • Mutation
    The CAT is inserted after the start codon.
  • GenBank ID
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)
  • Promoter The minimal 35S promoter from Cauliflower Mosaic Virus and the tetramer of its enhancer region.

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer TTCGcaagacccttcctcta
  • 3′ sequencing primer CCAACAAAACATTCACAATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The kanamycin resistance gene in this vector has base substitutions compared to the original sequence, but this is not a problem for selection in plants. The NdeI site of pVS1 in this vector is deleted due to mutation, but this has not caused any problems with growth in bacteria or transformation into plants.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKAN43Ag8-GFP was a gift from Keiichi Shimizu (Addgene plasmid # 178182 ; http://n2t.net/addgene:178182 ; RRID:Addgene_178182)