MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ
(Plasmid #178320)

• Purpose: Multiplex luciferase reporter vector, with luciferase reporters for the pathways HRE, P53, AP-1, FOXO and SMAD.
• Depositing Lab: Koen Venken
• Publication: Sarrion-Perdigones et al Methods Mol Biol. 2022;2524:409-432. doi: 10.1007/978-1-0716-2453-1_32.

Backbone

• Vector backbone: Omega Destination-CMV:ELuc:bgH
• Backbone manufacturer: Venken Lab, #124528
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 13678
• Vector type: Mammalian Expression, Luciferase, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: HRE RedFirefly reporter
• Alt name: Transcription Blocker + 4 copies of the HRE DNA binding motif + miniP, RedFirefly Luciferase
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2256

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: actccacccattgacgtcaatggaaag
• 3′ sequencing primer: agaatggcgccgggcctttc

Gene/Insert 2

• Gene/Insert name: P53 FLuc reporter
• Alt name: Transcription Blocker + 2 copies of the P53 DNA binding motif + miniP, Firefly Luciferase
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2218

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: caagaagcccgtggccaagatg
• 3′ sequencing primer: cggggtcataaaccttggaagtcattg

Gene/Insert 3

• Gene/Insert name: AP-1 Renilla reporter
• Alt name: Transcription Blocker + 6 copies of the AP-1 DNA binding motif + miniP, Renilla Luciferase
• Insert Size (bp): 1518

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: agggcggaaagatcgccgtg
• 3′ sequencing primer: CGAAGTCCTCCAAGGTAAACACCATTG

Gene/Insert 4

• Gene/Insert name: FOXO NLuc Reporter
• Alt name: Transcription Blocker + 3 copies of the DBE DNA binding motif + miniP, NLuc Luciferase
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1123

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: GTCCTGAAGAACGAACAGTGAGCTTC
• 3′ sequencing primer: CTGGGTCGTAGACTTTGGAAGCC

Gene/Insert 5

• Gene/Insert name: SMAD GrRenilla reporter
• Alt name: Transcription Blocker + 7 copies of the SMAD DNA binding motif + miniP, Green Renilla Luciferase
• Insert Size (bp): 1552

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: GAGGCTCTGCGAACGAATACTCG
• 3′ sequencing primer: ctt ttt acg gtt cct ggc ctt ttg

Resource Information

• Supplemental Documents:
  • DY614 Egg001 HRE-RF_p53-Fir_AP1-Ren_Foxo-NLuc_SMAD-GrRen.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry