pCAX-EGFP-FBP17
(Plasmid
#178365)
-
PurposeExpresses FBP17 c-terminal labeled with EGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAX
- Backbone size w/o insert (bp) 4698
- Total vector size (bp) 7297
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFormin Binding Protein 17
-
Alt nameFBP17
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1851
-
Entrez GeneFNBP1 (a.k.a. FBP17)
- Promoter Chicken Beta Actin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGCTCCTGGGCAACGTGC
- 3′ sequencing primer CACTCGGAAGGACATATGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAX-EGFP-FBP17 was a gift from Erik Dent (Addgene plasmid # 178365 ; http://n2t.net/addgene:178365 ; RRID:Addgene_178365) -
For your References section:
Opposing functions of F-BAR proteins in neuronal membrane protrusion, tubule formation, and neurite outgrowth. Taylor KL, Taylor RJ, Richters KE, Huynh B, Carrington J, McDermott ME, Wilson RL, Dent EW. Life Sci Alliance. 2019 Jun 3;2(3). pii: 2/3/e201800288. doi: 10.26508/lsa.201800288. Print 2019 Jun. 10.26508/lsa.201800288 PubMed 31160379