myristoylated ct-GRK2
(Plasmid
#178734)
-
PurposeN-myristoylation signaling peptide of Src and the C-terminal fragment of G-protein coupled receptor kinase 2 (ct-GRK2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178734 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFUGW
- Backbone size w/o insert (bp) 9173
- Total vector size (bp) 9572
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGRK2
-
Alt nameADRBK1
-
Alt nameBARK1
-
Alt nameBETA-ARK1
-
SpeciesB. taurus (bovine)
-
Insert Size (bp)426
-
Mutationonly amino acids 548-671
-
Entrez GeneGRK2 (a.k.a. ADRBK1)
- Promoter Ubiquitin
-
Tag
/ Fusion Protein
- Src 1-15 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aatttgtccgctaaattctggccg
- 3′ sequencing primer gtggatacgctgctttaatgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
myristoylated ct-GRK2 was a gift from Ege Kavalali (Addgene plasmid # 178734 ; http://n2t.net/addgene:178734 ; RRID:Addgene_178734) -
For your References section:
Presynaptic mechanisms underlying GABA(B)-receptor-mediated inhibition of spontaneous neurotransmitter release. Alten B, Guzikowski NJ, Zurawski Z, Hamm HE, Kavalali ET. Cell Rep. 2022 Jan 18;38(3):110255. doi: 10.1016/j.celrep.2021.110255. 10.1016/j.celrep.2021.110255 PubMed 35045279