pLm_gRNA1
(Plasmid
#178752)
-
PurposeExpression of a gRNA that targets next to PAM library, used for L. mobilis type I-E system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namea gRNA that targets next to PAM library, used for L. mobilis type I-E system
-
gRNA/shRNA sequenceAATTCTGGCGAATCCTTTAATTAACTGACCAG
-
SpeciesL. mobilis
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLm_gRNA1 was a gift from Chase Beisel (Addgene plasmid # 178752 ; http://n2t.net/addgene:178752 ; RRID:Addgene_178752) -
For your References section:
Rapid cell-free characterization of multi-subunit CRISPR effectors and transposons. Wimmer F, Mougiakos I, Englert F, Beisel CL. Mol Cell. 2022 Feb 16. pii: S1097-2765(22)00102-2. doi: 10.1016/j.molcel.2022.01.026. 10.1016/j.molcel.2022.01.026 PubMed 35216669