Skip to main content

pMs_gRNA1
(Plasmid #178764)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178764 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    ColE1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA that targets next to PAM library, used for Marinomonas sp. type I-E system
  • gRNA/shRNA sequence
    AATTCTGGCGAATCCTTTAATTAACTGACCAG
  • Species
    Marinomonas sp.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMs_gRNA1 was a gift from Chase Beisel (Addgene plasmid # 178764 ; http://n2t.net/addgene:178764 ; RRID:Addgene_178764)
  • For your References section:

    Rapid cell-free characterization of multi-subunit CRISPR effectors and transposons. Wimmer F, Mougiakos I, Englert F, Beisel CL. Mol Cell. 2022 Feb 16. pii: S1097-2765(22)00102-2. doi: 10.1016/j.molcel.2022.01.026. 10.1016/j.molcel.2022.01.026 PubMed 35216669