-
PurposeInducible expression of Taq DNA Ligase in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178798 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepATetO
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTaq DNA Ligase
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTCCCTATCAGTGATAGAGAAAACTAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pATetO 6XHis-Taq DNA Ligase was a gift from Andrew Ellington (Addgene plasmid # 178798 ; http://n2t.net/addgene:178798 ; RRID:Addgene_178798) -
For your References section:
Producing molecular biology reagents without purification. Bhadra S, Nguyen V, Torres JA, Kar S, Fadanka S, Gandini C, Akligoh H, Paik I, Maranhao AC, Molloy J, Ellington AD. PLoS One. 2021 Jun 1;16(6):e0252507. doi: 10.1371/journal.pone.0252507. eCollection 2021. 10.1371/journal.pone.0252507 PubMed 34061896