Skip to main content

pJH1579
(Plasmid #178904)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178904 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pBSK
  • Backbone manufacturer
    stratagene
  • Backbone size w/o insert (bp) 9215
  • Total vector size (bp) 12037
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YC3.60
  • Insert Size (bp)
    2822
  • Mutation
    See Depositor Comments Below
  • GenBank ID
  • Promoter Pglr-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EagI (not destroyed)
  • 5′ sequencing primer CCCCCGGGCcATGGTGAGCAAGGG
  • 3′ sequencing primer GCGATCTGATGACAGCGGCCGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains N165H and K213N mutations in YC3.60 and has a Ser3 deletion in Cerulean. These mutations are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH1579 was a gift from Mei Zhen (Addgene plasmid # 178904 ; http://n2t.net/addgene:178904 ; RRID:Addgene_178904)
  • For your References section:

    An imbalancing act: gap junctions reduce the backward motor circuit activity to bias C. elegans for forward locomotion. Kawano T, Po MD, Gao S, Leung G, Ryu WS, Zhen M. Neuron. 2011 Nov 17;72(4):572-86. doi: 10.1016/j.neuron.2011.09.005. 10.1016/j.neuron.2011.09.005 PubMed 22099460