Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSYC-201
(Plasmid #178963)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178963 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pminiTol2
  • Backbone size w/o insert (bp) 3323
  • Total vector size (bp) 13210
  • Vector type
    Tol2 mediated recombination

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Glial fibrillary acidic protein promoter
  • Alt name
    pGFAP
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    7405
  • GenBank ID
  • Entrez Gene
    gfap (a.k.a. cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485)
  • Promoter zebrafish gfap promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer AGGAGACGTAGGAGCGGCGAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Glial fibrillary acidic protein
  • Alt name
    GFAP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1456
  • GenBank ID
    NM_002055.5
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer CTTTCACCCCCCACATCAACTC
  • 3′ sequencing primer ACTTGTGGCCGTTTACGTCG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    EGFP-pA
  • Species
    Synthetic
  • Insert Size (bp)
    1014

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TGATATCTGGCGCGCCTACC
  • 3′ sequencing primer T3
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSYC-201 was a gift from Seok-Yong Choi (Addgene plasmid # 178963 ; http://n2t.net/addgene:178963 ; RRID:Addgene_178963)
  • For your References section:

    Aggregation-prone GFAP mutation in Alexander disease validated using a zebrafish model. Lee SH, Nam TS, Kim KH, Kim JH, Yoon W, Heo SH, Kim MJ, Shin BA, Perng MD, Choy HE, Jo J, Kim MK, Choi SY. BMC Neurol. 2017 Sep 7;17(1):175. doi: 10.1186/s12883-017-0938-7. 10.1186/s12883-017-0938-7 PubMed 28882119