pSYC-204
(Plasmid #178964)

• Purpose: Human GFAP (R79C) mutant fused to 3xFLAG tag and EGFP driven by zebrafish gfap promoter for Tol2 mediated recombination
• Depositing Lab: Seok-Yong Choi
• Publication: Lee et al BMC Neurol. 2017 Sep 7;17(1):175. doi: 10.1186/s12883-017-0938-7.

Backbone

• Vector backbone: pminiTol2
• Backbone size w/o insert (bp): 3323
• Total vector size (bp): 13210
• Vector type: Tol2 mediated recombination

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Glial fibrillary acidic protein promoter
• Alt name: pGFAP
• Species: D. rerio (zebrafish)
• Insert Size (bp): 7405
• GenBank ID:
• Entrez Gene: gfap (a.k.a. cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485)
• Promoter: Zebrafish gfap promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: AGGAGACGTAGGAGCGGCGAG

Gene/Insert 2

• Gene/Insert name: Glial fibrillary acidic protein
• Alt name: GFAP
• Species: H. sapiens (human)
• Insert Size (bp): 1456
• Mutation: R79C
• GenBank ID: NM_002055.5
• Entrez Gene: GFAP (a.k.a. ALXDRD)
• Tag / Fusion Protein:
  • 3xFLAG (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: CTTTCACCCCCCACATCAACTC
• 3′ sequencing primer: ACTTGTGGCCGTTTACGTCG

Gene/Insert 3

• Gene/Insert name: EGFP-pA
• Species: Synthetic
• Insert Size (bp): 1014

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: SphI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TGATATCTGGCGCGCCTACC
• 3′ sequencing primer: T3

Resource Information

• Supplemental Documents:
  • pSYC-204.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry