pSYC-204
(Plasmid
#178964)
-
PurposeHuman GFAP (R79C) mutant fused to 3xFLAG tag and EGFP driven by zebrafish gfap promoter for Tol2 mediated recombination
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepminiTol2
- Backbone size w/o insert (bp) 3323
- Total vector size (bp) 13210
-
Vector typeTol2 mediated recombination
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGlial fibrillary acidic protein promoter
-
Alt namepGFAP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)7405
-
GenBank ID
-
Entrez Genegfap (a.k.a. cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485)
- Promoter Zebrafish gfap promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer AGGAGACGTAGGAGCGGCGAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGlial fibrillary acidic protein
-
Alt nameGFAP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1456
-
MutationR79C
-
GenBank IDNM_002055.5
-
Entrez GeneGFAP (a.k.a. ALXDRD)
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SphI (not destroyed)
- 5′ sequencing primer CTTTCACCCCCCACATCAACTC
- 3′ sequencing primer ACTTGTGGCCGTTTACGTCG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameEGFP-pA
-
SpeciesSynthetic
-
Insert Size (bp)1014
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SphI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TGATATCTGGCGCGCCTACC
- 3′ sequencing primer T3 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSYC-204 was a gift from Seok-Yong Choi (Addgene plasmid # 178964 ; http://n2t.net/addgene:178964 ; RRID:Addgene_178964) -
For your References section:
Aggregation-prone GFAP mutation in Alexander disease validated using a zebrafish model. Lee SH, Nam TS, Kim KH, Kim JH, Yoon W, Heo SH, Kim MJ, Shin BA, Perng MD, Choy HE, Jo J, Kim MK, Choi SY. BMC Neurol. 2017 Sep 7;17(1):175. doi: 10.1186/s12883-017-0938-7. 10.1186/s12883-017-0938-7 PubMed 28882119