Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #178967)


Item Catalog # Description Quantity Price (USD)
Plasmid 178967 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2279
  • Total vector size (bp) 6240
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
  • Mutation
  • Promoter CMV
  • Tags / Fusion Proteins
    • no (N terminal on insert)
    • HO1 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer aaatgggcggtaggcgtgt
  • 3′ sequencing primer ggacaaaccacaactagaatgcagtg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-miRFP2-IRES-HO1-N1 was a gift from Kiryl Piatkevich (Addgene plasmid # 178967 ; ; RRID:Addgene_178967)
  • For your References section:

    Rapid directed molecular evolution of fluorescent proteins in mammalian cells. Babakhanova S, Jung EE, Namikawa K, Zhang H, Wang Y, Subach OM, Korzhenevskiy DA, Rakitina TV, Xiao X, Wang W, Shi J, Drobizhev M, Park D, Eisenhard L, Tang H, Koster RW, Subach FV, Boyden ES, Piatkevich KD. Protein Sci. 2022 Mar;31(3):728-751. doi: 10.1002/pro.4261. Epub 2021 Dec 30. 10.1002/pro.4261 PubMed 34913537