Skip to main content

pKeratin-emiRFP2-N1
(Plasmid #178972)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178972 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 3933
  • Total vector size (bp) 6180
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Keratin-emiRFP2
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
    2247

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer gctattgctttatttgtaaccattataagctgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a V282L mutation in Keratin. This mutation did not affect imaging by the depositing lab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKeratin-emiRFP2-N1 was a gift from Kiryl Piatkevich (Addgene plasmid # 178972 ; http://n2t.net/addgene:178972 ; RRID:Addgene_178972)
  • For your References section:

    Rapid directed molecular evolution of fluorescent proteins in mammalian cells. Babakhanova S, Jung EE, Namikawa K, Zhang H, Wang Y, Subach OM, Korzhenevskiy DA, Rakitina TV, Xiao X, Wang W, Shi J, Drobizhev M, Park D, Eisenhard L, Tang H, Koster RW, Subach FV, Boyden ES, Piatkevich KD. Protein Sci. 2022 Mar;31(3):728-751. doi: 10.1002/pro.4261. Epub 2021 Dec 30. 10.1002/pro.4261 PubMed 34913537