-
Purpose(Empty Backbone) piggyBac plasmid for 5' ENGRAM recorder
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepiggyBac-Puro
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
- Promoter minP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGGGATACGGGGAAAAGGCCTCCACGGCCA
- 3′ sequencing primer CGAAGTTATTAGGTCCCTCGACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-5'-ENGRAM was a gift from Jay Shendure (Addgene plasmid # 179157 ; http://n2t.net/addgene:179157 ; RRID:Addgene_179157) -
For your References section:
Symbolic recording of signalling and cis-regulatory element activity to DNA. Chen W, Choi J, Li X, Nathans JF, Martin B, Yang W, Hamazaki N, Qiu C, Lalanne JB, Regalado S, Kim H, Agarwal V, Nichols E, Leith A, Lee C, Shendure J. Nature. 2024 Aug;632(8027):1073-1081. doi: 10.1038/s41586-024-07706-4. Epub 2024 Jul 17. 10.1038/s41586-024-07706-4 PubMed 39020177