GFP-LacI-HIPK2
(Plasmid
#179269)
-
PurposeExpresses GFP-LacI-HIPK2 fusion protein
-
Depositing Lab
-
Depositing OrganizationJustus Liebig-Universitaet Giessen
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 179269-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 179269-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneGFP-LacI-polylinker
- Backbone size w/o insert (bp) 7304
- Total vector size (bp) 10862
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehomeodomain interacting protein kinase 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3576
-
GenBank IDNM_022740.5
-
Entrez GeneHIPK2 (a.k.a. PRO0593)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-LacI (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTGAAGGGCAATCAGCTGTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 179269-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 179269-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-LacI-HIPK2 was a gift from Lienhard Schmitz (Addgene plasmid # 179269 ; http://n2t.net/addgene:179269 ; RRID:Addgene_179269) -
For your References section:
Chromatin Targeting of HIPK2 Leads to Acetylation-Dependent Chromatin Decondensation. Haas J, Bloesel D, Bacher S, Kracht M, Schmitz ML. Front Cell Dev Biol. 2020 Sep 1;8:852. doi: 10.3389/fcell.2020.00852. eCollection 2020. 10.3389/fcell.2020.00852 PubMed 32984337